| DA735 |
E. coli. |
Bacteria. 15kb lin-15 Xba fragment in Bluescript. Rescues @ 25 ng/ml and 50 ng/ml, better at 25. Biosafety Level: BSL-1. |
| DA837 |
E. coli. |
Bacteria. E. coli. Str-R. Uracil auxotroph. DA837 is derived from OP50. DA837 is harder for worms to eat than most E. coli strains. Some mild Eat mutant worms are easier to distinguish from WT when grown on DA837 than when grown on other E. coli strains. Biosafety Level: BSL-1. |
| DA1917 |
E. coli. |
Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1. |
| DA2124 |
E. coli. |
Bacteria. E. coli strain carrying an avr-15::GFP fusion plasmid. Amp-R. Sac I Pst I fragment from K10B8 fused to transmembrane GFP from TM-1. Biosafety Level: BSL-1. |
| DA2211 |
E. coli. |
Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1. |
| GC363 |
E. coli. |
Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/ |
| HB101 |
E. coli [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. |
Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1. |
| HT115(DE3) |
E. coli [F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase]. |
Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1. |
| NA22 |
E. coli. |
Bacteria. Jim Lewis received this E. coli strain from Henry Epstein in 1977. It is a prototroph and the worms grow well on it in liquid, even when the bacteria are highly labeled with 35-S. It hasn't been tested to see if it is temperature sensitive. It should be distributed as "Jim Lewis' NA22" until it has been confirmed that this is a certified version of NA22. Biosafety Level: BSL-1. Grow on NGM. |
| OP50 |
E. coli. |
Bacteria. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. |
| OP50-1 |
E. coli. |
Bacteria. Streptomycin resistant strain of OP50 which is useful for growing C. elegans in bulk. Biosafety Level: BSL-1. |
| OP50-GFP |
E. coli. |
Bacteria. A strain of OP50 that contains a GFP plasmid (pFPV25.1) that is very fluorescent. Resistant to ampicillin. Originally published in Caenorhabditis elegans is a model host for Salmonella typhimurium. Labrousse A, Chauvet S, Couillault C, Kurz C, Ewbank J. Curr Biol. 2000 Nov 30;10(23):1543-5. |
| OP50-NeoR |
E. coli. |
Bacteria. OP50 transformed with pETMCN-EK (derived from pET-28b: Ori colE1, KanR) Kan-resistant plasmid. Resistant to Kanamycin, Neomycin, G418. Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. Biosafety Level: BSL-1. |
| PW20 |
E. coli. |
Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1. |
| SLE1 |
E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. |
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1. |
| X1666 |
E. coli. |
Bacteria. E. coli. Plasmidless, NAL-resistant, ARA-minus, Good growth, high density. Uracil prototroph. Biosafety Level: BSL-1. |
| NJF01 |
NJF01 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1, DE3, (delta)rnc-38). |
Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7. |
| OP50(xu363) |
E. coli [ura-, strR, rnc-, (delta)attB::FRT-lacI-lacUV5p-T7)]. |
Bacteria. RNAi-compatible OP50 strain. Slow growing. When growing this strain, pick single colonies for liquid culture (at least 20 hrs) from a freshly streaked tetracycline LB plate. Do not include tetracycline in liquid culture, as Tet in liquid culture can have long lasting effects on worm lifespan. The authors recommend using standard PEG transformation method to make competent OP50(xu363) cells, but other ways to make competent cells will also likely work for OP50(xu363). Reference: Xiao R, et al. Cell Rep. 2015 May 19;11(7):1123-33. |
| OP50/cytR- |
E. coli [cytR-] |
Bacteria. Kanamycin-resistant E. coli. cytR- mutation in OP50 background causes elavated nucleotide levels similar to HT115. A mutation in CytR- was introduced into the OP50 strain by recombineering. Bacterial cells were transformed with pSIM8 plasmid before using as hosts for recombineering. Targeting substrate DNA fragments were amplified by PCR and subcloned into TOPO cloning vector for sequence verification before being electroporated into the host bacterial cells. The primer set used for cloning targeting cytR substrate DNAs (to replace cytR+ with the cytR- mutation identified in HT115 strain): 5'- GCCAGGCGAGGAGTGAGTGTG-3'/5'-AGCGGCGGGCCTTTGACC-3'. Reference: Chi C, et al. Genes Dev. 2016 Feb 1;30(3):307-20. |
| OP50-tdTomato |
E. coli |
Bacteria. A22 tdTomato-expressing OP50. Amp Resistant. tdTomato coding sequence was cloned into pGEX-5x-3 vector and transformed into OP50 component cells. Reference: Zhang B, et al. Nat Aging 2021 1, 255–268. https://doi.org/10.1038/s43587-021-00039-1. |
| DRb546 |
E. coli |
Bacteria. Ampicillin & tetracycline resistant. E. coli HT115(DE3) strain carrying pREW2 plasmid expressing dsRNA luciferase. Can be used as a negative control for RNAi experiments in lieu of empty vector. Fragment of luciferase coding sequence was subcloned into L4440 to produce pREW2. Sequence inserted into pPD129.36(L4440) HindIII - XhoI sites: "cataaagaaaggcccggcgccattctatcctctagaggatggaaccgctggagagcaactgcataaggctatgaagagatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggtgaacatcacgtacgcggaatacttcgaaatgtccgttcggttggcagaagctatgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgc" Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681.e5. doi: 10.1016/j.celrep.2018.08.011. PMID: 30184501. |